Trans-Arctic distribution of marine fish digenean Progonus muelleri (Derogenidae) tested by molecular data

Full Text

Marine organisms with trans-Arctic distribution have been widely studied by molecular genetic methods in recent decades. Data on the genetic variability show that often instead of species with wide geographic ranges, complexes of cryptic or pseudocryptic species are common as a result of vicariance (Carr et al., 2011; Laakkonen et al., 2015, 2021; Kienberger et al., 2016; Borges et al., 2022; Chaban et al., 2023). Relevant studies on the marine parasites are few, and some species demonstrate genetic isolation between the Pacific and Atlantic, some do have continuous distribution across the Arctic, and others do not demonstrate high genetic divergence though they have interrupted geographic range (Galaktionov et al., 2012, 2023, 2024a, 2024b). Digenetic trematodes (Digenea) are of a special interest for the studies of genetic variability on a wide geographic scale for two reasons. First, cryptic species are substantially more abundant within this group than in other parasitic helminths (Pérez-Ponce de León, Poulin, 2018). Second, the host identity and biology play an important role in their complex life cycles, and may incite speciation (Huyse et al., 2005). Among the marine digeneans with the trans-Arctic distribution, only those utilizing birds as the definitive hosts have been somewhat investigated in terms of genetic variability (Gonchar, Galaktionov, 2020, 2022; Galaktionov et al., 2023). As for the digeneans in the marine fish, there are just a few data on trans-Arctic distributions, and no intensive effort with many isolates and several genetic markers has been made.

Superfamily Hemiuroidea Looss, 1899 is a promising group for the study of cryptic species complexes, as its representatives have a wide specificity for the definitive hosts, high morphological variability and tremendous geographical distributions. This study is focused on Progonus muelleri (Levinsen, 1881) Looss, 1899 (family Derogenidae Nicoll, 1910) which has been documented from most regions of the Northern Hemisphere, including the Pacific, Atlantic and both Canadian and Russian Arctic (Odhner, 1905; Issaitschikov, 1933; Polyansky, 1955; Zhukov, 1963; Brinkmann, 1975; Bray, 1979). Previous studies demonstrated that specimens of P. muelleri from the Pacific Northwest and the European sub-Arctic do not differ in 28S rDNA (Sokolov et al., 2021; Krupenko et al., 2022), a molecular marker that is often used to delimit species of the Digenea. However, the lack of difference in 28S rDNA sequence dataset solely cannot be conclusive to state species integrity, and the analysis of variable markers like internal transcribed spacers 1 and 2 (ITS1, ITS2) and mitochondrial genes is necessary. Additionally, isolates from the White Sea form two groups divergent in 18S rDNA, 28S rDNA, ITS2 and cox1 gene: P. muelleri PM1 and PM2 (Krupenko et al., 2022). To estimate if there are species-level differences within P. muelleri, in the present study, we performed the molecular analysis of isolates from distant regions: the European sub-Arctic (the White, Barents and Pechora Seas) and the Pacific Northwest (the Sea of Okhotsk and the Pacific coast of the northern Kuril Islands). We also described the life-cycle stages of P. muelleri from the first intermediate host in the Sea of Okhotsk, and compared them with the previously described ones of PM1 from the White Sea.

MATERIAL AND METHODS

Samples were collected in 2022–2024 from the European sub-Arctic seas (the White, Barents, and Pechora), and from the Pacific Northwest (the Sea of Okhotsk and the Pacific Ocean near the northern Kuril Islands) (table 1). Obtained putative life-cycle stages of P. muelleri (24 isolates) were fixed in 96% ethanol. Maritae were heat-killed prior to fixation. Some of the measurements (body length, oral sucker size) were taken from ethanol-fixed worms before cutting a piece for molecular analysis. Maritae and rediae were stained with acetocarmine (Sigma Aldrich, Germany), destained in 0.1 M HCl in 70% ethanol, dehydrated in a graded alcohol series, clarified in xylol, and mounted in BioMount medium (Bio Optica, Italy). Cercariae were observed alive and fixed in 2.5% glutaraldehyde in sea water for morphological descriptions. The whole mounts were studied under Leica DM 500 or Leica DM 2500 compound microscopes (Leica Microsystems, Germany) in bright field or with differential interference contrast (DIC). Photographs were taken using a Nikon DS Fi3 camera (Nikon, Japan) or with a smartphone camera. Measurements were made in Fiji software (Schindelin et al., 2012). All measurements are in micrometers.

 

Table 1. Geographical locations of sampling sites

Coordinates	Site	Area	Region
66°18'N 33°38'E	Keret Archipelago	Kandalaksha Bay	White Sea
69°06'N 36°03'E	Dalniye Zelentsy	Kola Peninsula	Barents Sea
69°50'N 59°24'E	Lyamchina Bay	Vaygach Island	Pechora Sea
69°42'N 60°03'E	Varnek Bay	Vaygach Island	Pechora Sea
59°33'N 151°17'E	Ola lagoon	Taui Bay	Sea of Okhotsk
59°31'N 150°45'E	Nagaev Bay	Taui Bay	Sea of Okhotsk
59°29'N 150°55'E	Veselaya Bay	Taui Bay	Sea of Okhotsk
59°33'N 150°54'E	Gertnera Bay	Taui Bay	Sea of Okhotsk
50°02'N 155°19'E	Vasilieva Bay	Paramushir Island	Kuril Islands

 

The list of isolates taken for the molecular analysis is in table 2. To extract DNA, we used fragments of maritae (piece of the oral sucker) and whole rediae fixed with 96% ethanol. They were dried completely in 1.5 ml tubes, incubated in 200 μl of 5% Chelex® 100 resin (Bio-Rad, USA) with 0.2 mg/ml proteinase K (Evrogen, Russia) at 56°C for 3–4 h, then heated for 8 min at 90°C and centrifuged for 10 min at 16,000 g. The supernatant with DNA was transferred into a new tube and stored at –20°C.

 

Table 2. Derogenidae analyzed in this study

Species	Stage	Host species	Region	GenBank accession numbers			Reference
				28S	ITS2	cox1
D. abba	marita	Hippoglossoides platessoides (Fabricius, 1780)	Svalbard, Arctic Ocean	—	—	PP384389	Bouguerche et al., 2024
D. abba	rediae and cercariae	Euspira pallida (Broderip & G. B. Sowerby I, 1829)	White Sea	—	—	OM807194	Krupenko et al., 2022
D. lacustris	marita	Galaxias maculatus (Jenyns, 1842)	Argentina	—	—	LC586092	Tsuchida et al., 2022
D. lacustris	marita	Percichthys trucha (Valenciennes, 1833)	Argentina	—	—	LC586093	Tsuchida et al., 2022
D. lacustris	marita	Salvelinus fontinalis (Mitchill, 1814)	Argentina	—	—	LC586094	Tsuchida et al., 2022
D. lacustris	marita	Oncorhynchus mykiss (Walbaum, 1792)	Argentina	—	—	LC586095	Tsuchida et al., 2022
D. lacustris	marita	P. trucha	Argentina	—	—	LC586096	Tsuchida et al., 2022
D. lacustris	marita	G. maculatus	Argentina	—	—	LC586097	Tsuchida et al., 2022
D. lacustris	marita	G. maculatus	Argentina	—	—	LC586098	Tsuchida et al., 2022
D. ruber	marita	Chelidonichthys lastoviza (Bonnaterre, 1788)	Western Mediterranean	—	—	OR245386	Gharbi et al., 2024
D. ruber	marita	Ch. lastoviza	Western Mediterranean	—	—	OR245546	Gharbi et al., 2024
D. varicus s. str.	marita	Limanda limanda (Linnaeus, 1758)	White Sea	—	—	OM807173	Krupenko et al., 2022
D. varicus s. str.	marita	Gadus morhua Linnaeus, 1758	White Sea	—	—	OM807174	Krupenko et al., 2022
D. varicus s. str.	marita	Myoxocephalus scorpius (Linnaeus, 1758)	White Sea	—	—	OM807175	Krupenko et al., 2022
D. varicus s. str.	marita	Anarhichas lupus Linnaeus, 1758	White Sea	—	—	OM807176	Krupenko et al., 2022
D. varicus s. str.	marita	L. limanda	White Sea	—	—	OM807177	Krupenko et al., 2022
D. varicus s. str.	marita	Eleginus nawaga (Walbaum, 1792)	White Sea	—	—	OM807178	Krupenko et al., 2022
D. varicus s. str.	marita	L. limanda	White Sea	—	—	OM807179	Krupenko et al., 2022
D. varicus s. str.	marita	Clupea pallasii Valenciennes, 1847	White Sea	—	—	OM807180	Krupenko et al., 2022
D. varicus s. str.	marita	Cl. pallasii	White Sea	—	—	OM807181	Krupenko et al., 2022
D. varicus s. str.	marita	G. morhua	Barents Sea	—	—	OM807182	Krupenko et al., 2022
D. varicus s. str.	marita	Myo. scorpius	Barents Sea	—	—	OM807183	Krupenko et al., 2022
D. varicus s. str.	marita	Myo. scorpius	Barents Sea	—	—	OM807184	Krupenko et al., 2022
D. varicus s. str.	rediae and cercariae	Cryptonatica affinis (Gmelin, 1791)	White Sea	—	—	OM807188	Krupenko et al., 2022
D. varicus s. str.	rediae and cercariae	Cr. affinis	White Sea	—	—	OM807189	Krupenko et al., 2022
D. varicus s. str.	rediae and cercariae	Cr. affinis	White Sea	—	—	OM807190	Krupenko et al., 2022
D. varicus s. str.	rediae and cercariae	Cr. affinis	Barents Sea	—	—	OM807191	Krupenko et al., 2022
D. varicus s. str.	rediae and cercariae	Cr. affinis	Barents Sea	—	—	OM807192	Krupenko et al., 2022
D. varicus s. str.	marita	Merlangius merlangus (Linnaeus, 1758)	North Sea	—	—	OR507183	Bouguerche et al., 2023
D. varicus s. str.	marita	Mer. merlangus	North Sea	—	—	OR507184	Bouguerche et al., 2023
Species	Stage	Host species	Region	GenBank accession numbers			Reference
				28S	ITS2	cox1
D. varicus s. str.	marita	Mer. merlangus	North Sea	—	—	OR507185	Bouguerche et al., 2023
D. varicus s. str.	marita	G. morhua	Norway, Svalbard, Arctic Ocean	—	—	OR140779	Bouguerche et al., 2023
D. varicus s. str.	marita	G. morhua	Norway, Svalbard, Arctic Ocean	—	—	OR140832	Bouguerche et al., 2023
D. varicus s. str.	marita	Mer. merlangus	North Sea	—	—	OR140894	Bouguerche et al., 2023
D. varicus s. str.	marita	G. morhua	Norway, Svalbard, Arctic Ocean	—	—	OR140895	Bouguerche et al., 2023
D. varicus s. str.	marita	G. morhua	North Sea	—	—	OR140896	Bouguerche et al., 2023
D. varicus s. str.	marita	Mer. merlangus	North Sea	—	—	OR140897	Bouguerche et al., 2023
D. varicus s. str.	marita	Mer. merlangus	North Sea	—	—	OR140909	Bouguerche et al., 2023
P. muelleri PM1	marita	Myo. scorpius	White Sea	OM761979	OM762019	OM807186	Krupenko et al., 2022
P. muelleri PM1	marita	Myo. scorpius	White Sea	OM761980	OM762020	OM807187	Krupenko et al., 2022
P. muelleri PM1	rediae and cercariae	Cr. affinis	White Sea	OM761992	OM762032	OM807196	Krupenko et al., 2022
P. muelleri PM1	rediae and cercariae	Cr. affinis	White Sea	OM761993	OM762033	OM807197	Krupenko et al., 2022
P. muelleri PM1 isolate D19.1	rediae and cercariae	Cr. affinis	Barents Sea	—	—	PQ463716	Present study
P. muelleri PM1 isolate D19.2	rediae and cercariae	Cr. affinis	Barents Sea	—	—	PQ463717	Present study
P. muelleri PM1 isolate D19.11	marita	Myo. scorpius	Barents Sea	—	—	PQ463718	Present study
P. muelleri PM1 isolate D45.2	marita	Myo. stelleri	Sea of Okhotsk	PQ568260	PQ567370	PQ463719	Present study
P. muelleri PM1 isolate D45.3	marita	Rhodymenichthys dolichogaster (Pallas, 1814)	Sea of Okhotsk	—	—	PQ463720	Present study
P. muelleri PM1 isolate D45.4	marita	Myo. jaok	Sea of Okhotsk	—	—	PQ463721	Present study
P. muelleri PM1 isolate D45.5	marita	Megalocottus platycephalus (Pallas, 1814)	Sea of Okhotsk	—	—	PQ463722	Present study
P. muelleri PM1 isolate D45.6	marita	Limanda aspera (Pallas, 1814)	Sea of Okhotsk	—	—	PQ463723	Present study
P. muelleri PM1 isolate D45.9	rediae and cercariae	Cryptonatica janthostoma (Deshayes, 1839)	Sea of Okhotsk	—	—	PQ463724	Present study
P. muelleri PM1 isolate D45.10	rediae and cercariae	Cr. janthostoma	Sea of Okhotsk	—	—	PQ463725	Present study
P. muelleri PM1 isolate D45.11	rediae and cercariae	Cr. janthostoma	Sea of Okhotsk	PQ568261	PQ567371	PQ463726	Present study
P. muelleri PM1 isolate D45.12	rediae and cercariae	Cr. janthostoma	Sea of Okhotsk	—	—	PQ463727	Present study
P. muelleri PM1 isolate D46.3	marita	Myo. scorpius	Barents Sea	—	PQ567372	PQ463728	Present study
P. muelleri PM1 isolate D46.4	marita	Myo. scorpius	Barents Sea	—	—	PQ463729	Present study
P. muelleri PM1 isolate D46.5	rediae and cercariae	Cr. affinis	Barents Sea	—	—	PQ463730	Present study
Species	Stage	Host species	Region	GenBank accession numbers			Reference
				28S	ITS2	cox1
P. muelleri PM1 isolate D46.7	marita	Myo. scorpius	Pechora Sea	—	PQ567373	PQ463732	Present study
P. muelleri PM1 isolate D48.5	marita	Lepidopsetta bilineata (Ayres, 1855)	Kuril Islands	—	—	PQ463735	Present study
P. muelleri PM1 isolate D48.6	marita	Hippoglossus stenolepis Schmidt, 1904	Kuril Islands	PQ568262	PQ567375	PQ463736	Present study
P. muelleri PM1 isolate D48.7	marita	Myo. scorpius	White Sea	—	—	PQ463737	Present study
P. muelleri PM1 isolate D48.8	metacercaria	Caprella septentrionalis Krøyer, 1838	Barents Sea	—	—	PQ463738	Present study
P. muelleri PM1 isolate D48.9	marita	Myo. scorpius	Barents Sea	PQ568263	—	PQ463739	Present study
P. muelleri PM2	marita	Myo. scorpius	White Sea	OM761978	OM762018	OM807185	Krupenko et al., 2022
P. muelleri PM2 isolate D46.6	marita	Myo. scorpius	Pechora Sea	—	—	PQ463731	Present study
P. muelleri PM2 isolate D46.8	marita	Myo. scorpius	Pechora Sea	—	—	PQ463733	Present study
P. muelleri PM2 isolate D46.9	marita	Myoxocephalus quadricornis (Linnaeus, 1758)	Pechora Sea	—	PQ567374	PQ463734	Present study
Allogenarchopsis problematica	redia	Semisulcospira libertina (A. Gould, 1859)	Japan	—	—	LC805323	Miura, Takisawa, 2024
Didymocystis wedli	marita	Thunnus orientalis (Temminck & Schlegel, 1844)	Japan	—	—	AB725624	Unpublished
Genarchopsis goppo	redia	S. libertina	Japan	—	—	LC805294	Miura, Takisawa, 2024
Thometrema patagonica	marita	P. trucha	Argentina	—	—	LC586100	Tsuchida et al., 2022

Newly obtained sequences are in bold.

 

We amplified partial 28S rDNA (D1–D3 domains), the complete ITS2 (with partial 5.8S and 28S rDNA), and the partial cox1 mitochondrial gene, with primers and conditions listed in table 3. The PCR mixture contained 4 μL of ScreenMix-HS (Evrogen), 0.5 μL of each primer (10 pmol/μL), 2 μL of DNA and 13 μL of PCR-grade water (Evrogen). PCRs were run on a BioRad T100 thermal cycler (Bio-rad Laboratories Inc., USA). PCR products were stained with 0.5% ethidium bromide and visualized through electrophoresis in a 1% agarose gel. Sequencing was performed with the PCR primers on an AB3500xL genetic analyzer (Applied Biosystems, USA). Geneious Prime 2023.2.1 (https://www.geneious.com) was used to assemble sequences and to build alignments. The relevant data for comparison were obtained from GenBank (table 2). Pairwise genetic distances (as the number of base differences per site) were calculated in MEGA 11 (Tamura et al., 2021). The haplotype network for cox1 gene sequences was constructed in PopART 1.7 (Leigh, Bryant, 2015) with the TCS network algorithm (Clement et al., 2002).

 

Table 3. Primers and PCR temperature profiles used in this study

Fragment	F/R	Name	Sequence (5′–3′)	Reference	Thermocycling profile
28S rDNA	F	digl2	AAGCATATCACTAAGCGG	Tkach et al., 1999	95°C 3 min (95°C 30 s, 54°C 30 s, 72°C 2 min) ×40 72°C 10 min
	R	1500R	GCTATCCTGAGGGAAACTTCG	Olson et al., 2003
ITS2	F	3S	GGTACCGGTGGATCACGTGGCTAGTG	Morgan, Blair, 1995	95°C 5 min (94°C 30 s, 55°C 30 s, 72°C 1 min) ×40 72°C 10 min
	R	ITS2.2	CCTGGTTAGTTTCTTTTCCTCCGC	Cribb et al., 1998
cox1 gene	F	JB3	TTTTTTGGGCATCCTGAGGTTTAT	Bowles et al., 1993	95°C 2 min (95°C 30 s, 52°C 40 s, 72°C 1 min) ×35 72°C 10 min
	R	trem.cox1.rrnl	AATCATGATGCAAAAGGTA	Králová-Hromadová et al., 2008

 

Alignments of nuclear rDNA markers were visually inspected for phylogenetically important substitutions. The phylogenetic analysis was run for the cox1 dataset. The substitution model was determined as HKY+G in MEGA 11 (Tamura et al., 2021) for the Maximum likelihood (ML) analysis, and as TN93+G+I in bModelTest (Bouckaert, Drummond, 2017) for the Bayesian inference (BI) analysis. The ML analysis was run in PhyML 3.0 (Guindon et al., 2010) with the standard bootstrap option with 1000 replicates. The BI analysis was conducted using Monte Carlo Markov Chain (MCMC) analysis available in Bayesian Evolutionary Analysis by Sampling Trees (BEAST2) (Bouckaert et al., 2019) on XSEDE at the CIPRES Science Gateway (https://www.phylo.org). Three independent runs of MCMC were performed, each with 10,000,000 generations and sampling every 1000 generations. The trace files were checked for convergence with Tracer v1.7 (Rambaut et al., 2018). The log files were combined using LogCombiner, discarding the first 10% as burn-in. Trees were summarized with TreeAnnotator using the maximum clade credibility tree option and with node heights as mean heights.

RESULTS

General account on Progonus muelleri occurrence

Data on inspected hosts and infection rates are provided in tables 4 and 5. In the Barents Sea, the maritae of P. muelleri were recovered from the European sculpin Myoxocephalus scorpius, metacercariae were found in the skeleton shrimps Caprella septentrionalis, and rediae with cercariae were obtained from the moon snail Cryptonatica affinis. In the White Sea, new isolates of P. muelleri maritae were recovered from Myo. scorpius. In the Pechora Sea, the maritae of P. muelleri were found in Myo. scorpius and in the fourhorn sculpin Myo. quadricornis.

 

Table 4. List of examined potential definitive hosts of Progonus muelleri and infection data

Region	Host order and family	Host species	N fish collected	N fish infected	Prevalence, %	Mean intensity	N isolates taken into molecular analysis
White Sea	Clupeiformes
	Clupeidae	Clupea pallasii	43	0	0	—	—
	Gadiformes
	Gadidae	Eleginus nawaga	46	0	0	—	—
		Gadus morhua	127	0	0	—	—
	Osmeriformes
	Osmeridae	Osmerus dentex	20	0	0	—	—
	Perciformes
	Agonidae	Agonus cataphractus	2	0	0	—	—
	Anarhichadidae	Anarhichas lupus	28	0	0	—	—
	Cottidae	Gymnocanthus tricuspis	1	0	0	—	—
		Myoxocephalus quadricornis	5	0	0	—	—
		Myoxocephalus scorpius	93	3	3.2	1.3	4
		Triglops murrayi	5	1	20	1	—
	Gasterosteidae	Gasterosteus aculeatus	5	0	0	—	—
	Zoarcidae	Zoarces viviparus	2	0	0	—	—
	Pleuronectiformes
	Pleuronectidae	Limanda limanda	116	1	0.9	1	—
		Liopsetta glacialis	27	0	0	—	—
		Platichthys flesus	80	0	0	—	—
	Salmoniformes
	Salmonidae	Coregonus lavaretus	6	0	0	—	—
		Oncorhynchus gorbuscha	5	0	0	—	—
Barents Sea	Gadiformes
	Gadidae	Gadus morhua	25	0	0	—	—
		Melanogrammus aeglefinus	3	0	0	—	—
		Pollachius virens	2	0	0	—	—
	Perciformes
	Cottidae	Gymnocanthus tricuspis	6	0	0	—	—
		Myoxocephalus scorpius	12	4	33.3	1.3	5
	Pleuronectiformes
	Pleuronectidae	Platichthys flesus	1	0	0	—	—
		Pleuronectes platessa	1	0	0	—	—
	Salmoniformes
	Salmonidae	Salmo salar	1	0	0	—	—
Pechora Sea	Gadiformes
	Gadidae	Eleginus nawaga	20	0	0	—	—
	Perciformes
	Cottidae	Myoxocephalus scorpius	6	3	50	1.0	3
		Myoxocephalus quadricornis	2	1	50	3	1
		Gymnocanthus tricuspis	1	0	0	—	—
	Pleuronectiformes
	Pleuronectidae	Liopsetta glacialis	1	0	0	—	—
Sea of Okhotsk	Gadiformes
	Gadidae	Gadus chalcogrammus	1	0	0	—	—
	Osmeriformes
	Osmeridae	Osmerus dentex	1	0	0	—	—
	Perciformes
	Cottidae	Myoxocephalus stelleri	4	3	75	5.7	1
		Myoxocephalus jaok	2	2	100	8.0	1
		Megalocottus platycephalus	2	2	100	1.0	1
		Porocottus minutus	1	0	0	—	—
	Gasterosteidae	Pungitius pungitius	1	0	0	—	—
	Hexagrammidae	Hexagrammos stelleri	2	0	0	—	—
		Hexagrammos octogrammus	1	0	0	—	—
	Pholidae	Rhodymenichthys dolichogaster	1	1	100	1	—
	Stichaeidae	Alectrias alectrolophus	4	0	0	—	—
	Pleuronectiformes
	Pleuronectidae	Limanda aspera	4	4	100	5.0	1
	Salmoniformes
	Salmonidae	Oncorhynchus gorbuscha	2	0	0	—	—
		Oncorhynchus keta	1	0	0	—	—
		Oncorhynchus kisutch	3	0	0	—	—
		Oncorhynchus nerka	1	0	0	—	—
Kuril Islands	Gadiformes
	Gadidae	Gadus chalcogrammus	1	0	0	—	—
		Gadus macrocephalus	1	0	0	—	—
	Perciformes
	Cottidae	Hemilepidotus papilio	1	0	0	—	—
		Myoxocephalus stelleri	1	1	100	11.0	—
	Pleuronectiformes
	Pleuronectidae	Hippoglossus stenolepis	3	3	100	3.0	1
		Lepidopsetta bilineata	2	1	50	1	1

 

Table 5. List of examined potential first intermediate hosts of Progonus muelleri (Gastropoda: Naticidae) and infection data

Region	Host species	N specimens collected	N specimens infected	Prevalence, %	N isolates taken into molecular analysis
White Sea	Amauropsis islandica	44	0	0	—
	Crypronatica affinis	498	5	1.00	2
	Euspira pallida	71	0	0	—
Barents Sea	Crypronatica affinis	247	3	1.21	3
	Euspira pallida	32	0	0	—
Sea of Okhotsk	Cryptonatica jantostoma	173	11	6.36	4

 

In the Sea of Okhotsk, maritae of P. muelleri were found in the yellowfin sole Limanda aspera, the Steller’s sculpin Myo. stelleri, the plain sculpin Myo. jaok, the belligerent sculpin Megalocottus platycephalus, and in the stippled gunnel Rhodymenichthys dolichogaster. At the Pacific coast of the northern Kuril Islands, P. muelleri maritae were recovered from the Pacific halibut Hippoglossus stenolepis, the Pacific rock sole Lepidopsetta bilineata, and Myo. stelleri. Rediae with cercariae similar to those of P. muelleri PM1 were recovered from the moon snail Cr. janthostoma from the Sea of Okhotsk.

Variation of nuclear rDNA markers

Partial 28S rDNA sequences were obtained for four new isolates: two from the Sea of Okhotsk, one from the Kuril Islands and one from the Barents Sea. They were 1128–1132 base pairs (bp) long, and completely identical to the previously published 28S rDNA sequences of PM1 (OM761979–81, OM761992–3). All PM1 sequences differed from those of PM2 (OM761978, OM761982–3) by one substitution.

Sequences containing ITS2 flanked with the partial 5.8S and 28S rDNA, 514–554 bp long, were obtained for six new isolates: one from the Barents Sea, two from the Pechora Sea, two from the Sea of Okhotsk, and one from the Kuril Islands. They split into two groups. A single sequence from the Pechora Sea was identical to the previously published ITS2 sequences of PM2 from the White Sea (OM762018, OM762022–3). The rest of the new sequences were identical to the ones of PM1 from the White Sea (OM762019–21, OM762032–33). The difference between PM1 and PM2 was in a single nucleotide. Sequences from the Sea of Okhotsk and from the Kuril Islands were obtained for the same isolates as in the 28S rDNA analysis, and they all matched the PM1 group.

Variation of mitochondrial cox1 gene

Fragments of cox1 mtDNA (795 bp long) were obtained for 24 new isolates of P. muelleri. Five sequences from Krupenko et al. (2022) were also included in the analysis. Thus, the alignment comprised 29 sequences, and it was trimmed to the shortest one, 788 bp. The cox1-based haplotype network is in figure 1. Two highly diverged groups were evident in the network, with a minimal intergroup distance 0.066 ± 0.009 (52 substitutions) (supplementary table 1). These groups corresponded to PM1 and PM2 from the nuclear marker analysis and from the previously published data on cox1 (Krupenko et al., 2022). The distances within groups did not exceed 0.021 ± 0.005 (16 substitutions). PM2 comprised three haplotypes, two from the Pechora Sea, and one from the White Sea. Within PM1, we had isolates from all the sampled areas. Also, PM1 split into two subsets (PM1a and PM1b) matching the geographical origin: one subset comprised isolates from the European seas, and the other from the Pacific Northwest. The maximal genetic distances within the European subset were 0.003 ± 0.002 (2 substitutions); within the Pacific subset, the distances were higher, up to 0.010 ± 0.004 (8 substitutions). The minimal distance between the subsets was 0.014 ± 0.004 (11 substitutions).

 

Figure 1. Haplotype network of Progonus muelleri isolates (N = 29) based on partial cox1 gene sequences. Circle size represents the haplotype frequency. Black dots indicate missing haplotypes. Number of hatch marks corresponds to the number of substitutions between haplotypes. Colored background indicates three haplogroups within the P. muelleri species complex. Isolates taken from first intermediate hosts labeled purple, from second intermediate hosts labeled pink, and from definitive hosts labeled black. Asterisks mark the isolates for which nuclear ribosomal data are available (see table 2). Abbreviations: Cap_sep – Caprella septentrionalis; Cry_aff – Cryptonatica affinis; Cry_jan – Cryptonatica janthostoma; Hip_ste – Hippoglossus stenolepis; Lep_bil – Lepidopsetta bilineata; Lim_asp – Limanda aspera; Meg_pla – Megalocottus platycephalus; Myo_jao – Myoxocephalus jaok; Myo_qua – Myoxocephalus quadricornis; Myo_sco – Myoxocephalus scorpius; Myo_ste – Myoxocephalus stelleri; Rho_dol – Rhodymenichthys dolichogaster.

 

The 11 isolates in the Pacific subset PM1b formed ten different haplotypes. In the European subset PM1a, there were only four haplotypes among 14 isolates. Three of these haplotypes were restricted to the White Sea, and one more, the dominant, combined isolates from the Barents and Pechora Seas.

For the phylogenetic reconstruction, we removed the identical sequences from our cox1 dataset of P. muelleri, and added other species from the subfamily Derogeninae: Derogenes varicus (Müller, 1784) Looss, 1901, D. abba Bouguerche, Huston, Karlsbakk, Ahmed & Holovachov, 2024, D. ruber Lühe, 1900, and D. lacustris Tsuchida, Flores, Viozzi, Rauque & Urabe, 2021. The following outgroups were selected: Allogenarchopsis problematica (Faust, 1924) Urabe & Shimazu, 2013, Didymocystis wedli Ariola, 1902, Genarchopsis goppo Ozaki, 1925, and Thometrema patagonicum (Szidat, 1956) Lunaschi & Drago, 2001. The alignment comprised 59 sequences, and after trimming it was 788 bp long. ML and BI analyses resulted in similar tree topologies, except for the relationship between D. abba and D. ruber (fig. 2A). Two groups of P. muelleri (PM1 and PM2) were closely related to each other with 99% (ML) and 1 (BI) support values. They formed a common branch with a clade comprising D. varicus, D. abba, and D. ruber, with high support values in both ML and BI analyses. Derogenes lacustris fell separately from the other species of the genus. All species-level taxa were well-supported. Within PM1, the isolates from the European seas (PM1a) formed a well-supported clade (fig. 2B). PM1b from the Pacific Northwest was resolved as paraphyletic. Within both PM1a and PM2, the most diverged were the isolates from the White Sea.

 

Figure 2. Phylogenetic relationships within the Derogeninae resulting from Maximum Likelihood analysis based on partial cox1 gene sequences. A. Complete tree (nodes with sequence differences below 0.02 are collapsed). B. Expanded part of A (in rectangle) with Progonus sequences. Bootstrap support values in percent are shown at nodes, followed by posterior probabilities from the tree built for the same dataset with BI method. Support values lower than 75 (ML) and 0.9 (BI) are not shown. Scale bars show the substitution rate. Newly generated sequences are in bold.

 

General considerations on morphology

Molecular data outline three groups within Progonus muelleri: PM1a, PM1b and PM2. The measurements of maritae for these groups are given separately in table 6, together with the measurements from Odhner (1905). Maritae of PM1a and PM1b were very similar in metrical characteristics. However, the sucker ratio was smaller in PM1b, as well as the range of egg lengths. Maritae of PM2 were generally larger than those of PM1, and in this characteristic closer to the specimens of Odhner. The sucker ratio was higher in PM2. Among the non-metrical characters, one was conspicuous: the wall of the sinus sac was substantially thinner in PM2 than in PM1, and thus the outline of this organ was barely visible (fig. 3).

 

Table 6. Measurements of Progonus muelleri maritae

Measured character	P. muelleri (Odhner, 1905)	PM1a (based on 8 hologenophores1)	PM1b (based on 7 hologenophores)	PM2 (based on 5 hologenophores2)
Body length	1500–2000	1231 (745–1827)	1222 (848–1575)	1724 (1351–2110)
Body maximum width	370–500	326 (242–471)	342 (229–471)	449 (359–610)
Forebody	N/A	559 (300–828)	523 (362–727)	714 (548–973)
Forebody to body length ratio	N/A	45 (40–48) %	43 (33–49) %	41 (39–46) %
Post-cecal region	N/A	163 (115–206)	186 (118–286)	303 (206–390)
Oral sucker	150–180 (diameter)	121 (97–147) × 131 (97–153)	136 (96–166) × 137 (98–174)	152 (104–182) × 164 (115–225)
Ventral sucker	320–400 (diameter)	241 (174–351) × 256 (176–362)	246 (172–325) × 253 (179–345)	363 (291–464) × 379 (294–464)
Sucker-length ratio	2.13–2.22 (calculated from minimal and maximal diameter values)	2.01 (1.65–2.44)	1.79 (1.39–2.11)	2.44 (2.08–2.80)
Sucker-width ratio		2.02 (1.67–2.58)	1.91 (1.53–2.38)	2.34 (2.06–2.56)
Pharynx	85	62 (49–73) × 74 (62–85)	66 (53–79) × 73 (37–91)	72 (60–96) × 91 (73–126)
Sinus sac	N/A	72 (59–86) × 85 (72–112)	76 (54–90) × 92 (65–116)	76 (64–114) × 86 (78–104)
Sinus organ length	25	32 (23–40)	28 (21–38)	37 (26–56)
Pars prostatica length	N/A	118 (65–184)	98 (61–166)	145 (116–161)
Seminal vesicle	N/A	86 (53–148) × 54 (28–62)	116 (78–179) × 57 (44–71)	154 (111–173) × 77 (65–93)
Left testis	N/A	85 (65–110) × 80 (32–113)	115 (92–146) × 104 (57–142)	139 (125–164) × 116 (103–134)
Right testis	N/A	107 (78–166) × 76 (49–123)	119 (86–142) × 94 (50–142)	139 (113–167) × 119 (95–142)
Ovary	N/A	129 (98–186) × 105 (63–177)	113 (70–149) × 92 (62–120)	141 (111–177) × 119 (78–151)
Left vitelline mass	N/A	142 (99–203) × 106 (76–173)	104 (52–142) × 80 (61–104)	136 (124–144) × 91 (80–100)
Right vitelline mass	N/A	135 (93–206) × 90 (50–129)	101 (65–131) × 83 (59–113)	136 (123–148) × 102 (94–114)
Eggs	54–60 × 25–29	53 (44–63) × 26 (22–31)	49 (41–55) × 25 (20–31)	50 (43–56) × 26 (21–30)

¹Five new specimens and three specimens from Krupenko et al. (2022). Some measurements of hologenophores from the previous study are revised and corrected.
²Three new specimens and two specimens from Krupenko et al. (2022). Some measurements of hologenophores from the previous study are revised and corrected.

 

Figure 3. Sinus sac and sinus organ in maritae of PM1a (A), PM1b (B) and PM2 (С). Acetocarmine, DIC. Abbreviations: so – sinus organ, ssw – sinus sac wall.

 

Cercariae of PM1b from Cr. janthostoma (fig. 4A) were apparently different from those of PM1a from Cr. affinis (fig. 4B) previously described from the White Sea (Krupenko et al., 2022). The caudal cyst of PM1b was larger; the fin was different in shape, wider; immotile threads were shorter and more numerous (11–13 versus 7–11, often 8 in PM1a). Below we provide infection data for PM1b and describe its intramolluscan life-cycle stages. For the prevalence and intensity values in the definitive hosts, we assume that all the P. muelleri maritae obtained from the Pacific Northwest belong to PM1b. We also suggest referring to the genetic lineages of P. muelleri defined through molecular data as ‘Progonus cf. muelleri’ followed by a genetic group name.

 

Figure 4. Comparison of cercariae of PM1b (A) and PM1a (B); host names and photographs placed along with the cercariae drawings. Abbreviations: ap – caudal cyst aperture, cb – cercaria body, dt – delivery tube, fi – fin, ic – inner cyst layer, it – immotile threads, la – locomotory appendage, oc – outer cyst layer.

 

Description of Progonus cf. muelleri PM1b

Family Derogenidae Nicoll, 1910
Subfamily Derogeninae Nicoll, 1910
Genus Progonus Looss, 1899
Localities: Taui Bay (Sea of Okhotsk); Paramushir Island (Kuril Islands).
Definitive hosts: Limanda aspera, Myoxocephalus stelleri, Myo. jaok, Megalocottus platycephalus, Rhodymenichthys dolichogaster, Hippoglossus stenolepis, Lepidopsetta bilineata.

Site in definitive host: stomach.

Prevalence in definitive host: 4 of 4 Lim. aspera, 2 of 2 Meg. platycephalus, 3 of 4 Myo. stelleri, 2 of 2 Myo. jaok, 1 of 1 R. dolichogaster (Taui Bay, Sea of Okhotsk); 2 of 2 H. stenolepis, 1 of 1 Lep. bilineata, 1 of 1 Myo. stelleri (Paramushir Island, Kuril Islands).

Mean intensity in definitive host: 5 in Lim. aspera, 1 in Meg. platycephalus, 5.7 in Myo. stelleri, 8 in Myo. jaok, 1 in R. dolichogaster (Taui Bay, Sea of Okhotsk); 2.5 in H. stenolepis, 1 in Lep. bilineata, 11 in Myo. stelleri (Paramushir Island, Kuril Islands).

First intermediate host: Cryptonatica janthostoma (Deshayes, 1839) (Caenogastropoda, Littorinimorpha, Naticidae).

Site in first intermediate host: reproductive and digestive glands.

Prevalence in first intermediate host: Gertner Bay 6.0%, N = 67; Nagaev Bay 7.7%, N = 26; Ola lagoon 1.5%, N = 65; Veselaya Bay 20.0%, N = 15.

Voucher material: Isogenophores 2024.11.13.001–003 of isolates D45.9, D45.11 and D45.12, and hologenophores 2024.11.13.004–10 of isolates D45.2, D45.3, D45.4, D45.5, D45.6, D48.5 and D48.6 are deposited in the Helminths collection of the Zoological Institute of the Russian Academy of Sciences (ZISP), section Trematoda (non-type material).

Representative DNA sequences in GenBank: PQ568260–2 (28S); PQ567370–1, PQ567375 (ITS2); PQ463719–27, PQ463735–6 (cox1).

Maritae structure complies with the description of Levinsen (1881) and to the redescriptions by Odhner (1905) and Bouguerche et al. (2024). The measurements based on seven hologenophores are provided in table 6. Our specimens were smaller than those of Odhner on average, and the sucker ratio was smaller. Eggs were also smaller on average than in the descriptions of Levinsen (1881) and Odhner (1905).

Rediae measurements based on 16 ethanol-fixed worms from three different host specimens. Rediae vermiform, 2262 (1322–3487) × 233 (167–303). Pharynx 54 (43–68) × 42 (35–51). Cecum 1085 (593–1640) long, 49 (32–71)% of body length. Birth pore near mouth opening. Infective cercariae found only in isolate D45.12. Rediae with infective cercariae generally bigger (2216–3487), though proportions of body and organs similar to those of smaller rediae with developing cercariae.

Infective cercariae measurements based on ten glutaraldehyde-fixed specimens. Cercariae of cystophorous type, with tail forming caudal cyst 403 (380–416) long, rounded in cross section, maximal diameter 87 (77–109). Anterior end spherical, with aperture, opposite end pointed. Cyst two-layered, with broad space between layers. Outer layer forming heart-shaped fin at pointed end, 121 (108–131) long, 105 (77–119) wide. Delivery tube and cercaria body within cyst in infective cercariae. Locomotory appendage attached near fin base, 284 (267–303) long, 19 (17–21) in diameter at base. At end of locomotory appendage, 11–13 immotile threads, 314 (283–350) long.

DISCUSSION

Criteria for species recognition are widely discussed in light of constantly emerging new molecular data. For the trematodes, Bray et al. (2022) proposed that differentiation of any two close species must be based on (1) reciprocal monophyly in the most discriminating available molecular marker, and (2) either morphological differences or distinct host distribution. Here, we tested this model of species recognition on Progonus muelleri, one of the fish hemiuroid trematodes with the widest geographic range covering the Arctic, Atlantic and Pacific Oceans in the Northern Hemisphere (Levinsen, 1881; Odhner, 1905; Issaitschikov, 1933; Polyansky, 1955; Zhukov, 1963; Brinkmann, 1975; Bray, 1979).

Progonus muelleri has quite a wide specificity for the definitive hosts, being recorded from over 60 fish species (summarized at WoRMS, 2024). However, it tends to occur more often in sculpins and flatfishes. The life cycle of P. muelleri has been described recently; it involves the naticid gastropod Cryptonatica affinis as the first intermediate host and caprellid amphipods as the second (Sokolov et al., 2021; Krupenko et al., 2022). Previous data also showed the possible existence of cryptic species within P. muelleri, lineages PM1 and PM2, living in sympatry in the White Sea (Krupenko et al., 2022). In the present study, new isolates of P. muelleri maritae were obtained from the Barents and Pechora Seas, and from the Pacific Northwest from several fish species. Along with this, in the Pacific Northwest, rediae and cercariae morphologically similar to those of P. muelleri PM1 were obtained from another first intermediate host, Cr. janthostoma. Through the nuclear markers (28S rDNA and ITS2), isolates from the Pacific Northwest were identical to the ones of PM1 from the European sub-Arctic. Consistent results were obtained from the analysis of cox1 gene fragments, indicating high similarity of PM1 isolates from the European sub-Arctic and from the Pacific Northwest. Moreover, these isolates differ from each other less than those of PM1 and PM2 in sympatry. This indicates that PM1 and PM2 probably represent two different species. Notably, intermediate hosts are known only for PM1, not for PM2. Of these, one may represent P. muelleri sensu stricto. However, we can’t tell exactly which one, as the maritae of these species demonstrate minor morphological differences, and both are similar to the type material described by Levinsen (1881) and to the more detailed redescriptions by Odhner (1905) and Bouguerche et al. (2024).

In general, sampled maritae of PM2 are bigger, and their sucker ratio is greater than in PM1, though the ranges overlap. A possible good differential characteristic is linked with the sinus sac: its wall is visibly thinner in PM2. The documented distribution of PM1 and PM2 may be a clue to the question of which one of them is P. muelleri sensu stricto. PM1 has been sampled in regions both with high salinity (like the south coast of the Barents Sea) and lower salinity (the White and Pechora Seas). PM2 has been sampled only in the White and Pechora Seas, not in the Barents Sea. Thus, its distribution may be restricted to the regions with the salinity below an average oceanic, possibly depending on the distribution of the first intermediate host which is yet unknown. The type locality of P. muelleri is the West Greenland Shelf (Levinsen, 1881), an area with normal oceanic salinity (Rysgaard et al., 2020). So PM1 is more likely to be P. muelleri s. str. However, as long as strong evidence is lacking, we suggest the usage of temporary names P. cf. muelleri PM1 and P. cf. muelleri PM2.

Another question is the conspecificity of the two distant lineages of PM1 from the European sub-Arctic (PM1a) and from the Pacific Northwest (PM1b). They do not differ in the analyzed nuclear markers, but demonstrate clear divergence in the cox1 gene. It could be intraspecific and resulting from geographic remoteness enhanced by the life-cycle traits: usage of benthic crustaceans as the second intermediate hosts (instead of planktonic in the related species of Derogenes (Køie, 1979)) and sedentary fish (sculpins and flatfishes) as preferred definitive hosts. However, differences between PM1a and PM1b in the structure of cercariae and first intermediate host species may rather be treated as interspecific. Alternatively, these differences could be host-induced and intraspecific, if PM1 utilizes various species of the genus Cryptonatica as the first intermediate hosts. We suggest that the latter hypothesis is likely improbable, but to reject it more data are needed: either material from Cr. affinis from the Pacific Northwest for comparison, or experiments on cross-infection of the first intermediate hosts. If PM1b appears distinct from PM1a, it should be described as a new species. An uncertainty of the PM1b status is also due to our cox1-based phylogeny (Fig. 2): PM1b is not resolved as monophyletic, and thus does not meet the most important taxonomic criterion (Bray et al., 2022). So, isolates of P. muelleri should probably be tested with alternative markers, or with an extended dataset comprising more derogenids.

It is also important to point out that the circumpolar distribution of Cr. affinis has never been tested by the molecular methods, and we cannot be sure that Cr. affinis from the Pacific is the same as in the Arctic and Atlantic. Preliminary unpublished data indicate that even in the White Sea two species of “Cr. affinis” live in sympatry (Dr T. Neretina, personal communication). Thus, the lack of knowledge on the host cryptic diversity hinders the investigations on parasites.

Regarding the genetic variation in cox1 gene, there are a few more details to discuss. First is the lack of shared haplotypes between the White Sea and nearby Barents and Pechora Seas both in PM1 and PM2. This suggests a restricted gene flow between these areas, and is probably linked with the low mobility of all the hosts in the life cycle (Blasco-Costa et al., 2012). Such restrictions may eventually incite speciation (Huyse et al., 2005). Second, the haplotype diversity of PM1b from the Pacific Northwest is much higher than that of PM1a in the European sub-Arctic. This indicates possible bottleneck occurrence for the PM1a, and suggests the Pacific origin of the whole PM1 lineage. The position of PM1b isolates on the cox1-based tree supports this conclusion. Thus, in this respect, PM1 is similar to the majority of the marine organisms in the Arctic which have a Pacific origin (Vermeij, 1991; Briggs, 2003). Further speculations on how the lineages of P. muelleri diverged, and is there a clear genetic gap between PM1a and PM1b, are limited by the lack of data from the Arctic seas of Siberia.

The interrelationships within the subfamily Derogeninae resolved here with the cox1 data are similar to the previous assessment through the 28S rDNA sequences (Bouguerche et al., 2023, 2024). Notably, D. lacustris forms a branch separate from the other species of the genus which have sister relationships with the P. muelleri complex. This indicates that D. lacustris should be probably transferred to a separate genus, differentiated through its affinity to the freshwater environment. However, there are 24 more species of the Derogenes lacking any molecular data. These are needed for a well-grounded revision of the Derogeninae and a differential diagnosis of a new genus for D. lacustris.

ACKNOWLEDGEMENTS

We thank our colleagues who helped with sample collection, especially Anastasia Lianguzova, Vladimir Krapivin, Dr Valeriia Khabibulina (Saint Petersburg University, Saint Petersburg, Russia) and Dr Aleksei Miroliubov (Zoological Institute of the Russian Academy of Sciences, Saint Petersburg, Russia). We are also grateful to the staff of institutions which provided facilities for field-work, specifically, the N.A. Pertsov White Sea Biological Station of Lomonosov Moscow State University, and Biological Research Station of Murmansk Marine Biological Institute of the Russian Academy of Sciences in Dalnie Zelentsy. For the experimental work, the equipment of the resource center “Molecular and Cell Technologies” of the Research Park of SPbU was used. We also thank Dr Anna Romanovich for excellent sequencing.

FUNDING

The study was performed with financial support of Russian Science Foundation, project No 23-24-00376, https://rscf.ru/project/23-24-00376/.

CONFLICT OF INTEREST

The authors of this work declare that they have no conflicts of interest.

SUPPLEMENTARY MATERIAL

Supplementary table 1 is available through the following link: https://doi.org/10.13140/RG.2.2.21423.44961.

About the authors

D. Yu. Krupenko

Zoological Institute of the Russian Academy of Sciences; Saint Petersburg University

Author for correspondence.
Email: krupenko.d@gmail.com
Russian Federation, Universitetskaya emb., 1, Saint Petersburg, 199034; Universitetskaya emb., 7/9, Saint Petersburg, 199034

G. A. Kremnev

Zoological Institute of the Russian Academy of Sciences

Email: krupenko.d@gmail.com
Russian Federation, Universitetskaya emb., 1, Saint Petersburg, 199034

A. G. Gonchar

Zoological Institute of the Russian Academy of Sciences; Saint Petersburg University

Email: krupenko.d@gmail.com
Russian Federation, Universitetskaya emb., 1, Saint Petersburg, 199034; Universitetskaya emb., 7/9, Saint Petersburg, 199034

O. A. Skobkina

Zoological Institute of the Russian Academy of Sciences

Email: krupenko.d@gmail.com
Russian Federation, Universitetskaya emb., 1, Saint Petersburg, 199034

K. V. Regel

Institute of the Biological Problems of the North, Far Eastern Branch of the Russian Academy of Sciences

Email: krupenko.d@gmail.com
Russian Federation, Portovaya str., 18, Magadan, 685000

References

Supplementary files